Sequence retrieval

Genome: Methanococcoides burtonii DSM 6242
Start position: 589822
End position: 589851
Length: 30

DNA sequence
>NC_007955, from 589822 to 589851 (30 bp); Methanococcoides burtonii DSM 6242 ATTTCTTCTTATTTCTTGTATTTTCTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 589728-589955	Sequence	Mbur_0579 - hypothetical protein (Protein is coded in complementary strand; from 589955 to 589728)