Sequence retrieval

Genome: Methanococcoides burtonii DSM 6242
Start position: 473914
End position: 473949
Length: 36

DNA sequence
>NC_007955, from 473914 to 473949 (36 bp); Methanococcoides burtonii DSM 6242 ATTTTCTCCCTAGTTTTCTCCCTAGTTTTCCCCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 473746-475173	Sequence	Mbur_0482 - divergent AAA ATP (Protein is coded in complementary strand; from 475173 to 473746)