Sequence retrieval

Genome: Methanococcoides burtonii DSM 6242
Start position: 1641748
End position: 1641792
Length: 45

DNA sequence
>NC_007955, from 1641748 to 1641792 (45 bp); Methanococcoides burtonii DSM 6242 GTATCCTCTTTTGTAGTGTTCTCCTTTGTAGTGTTCTCCTTTGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1641361-1642011	Sequence	Mbur_1564 - hypothetical protein (Protein is coded in complementary strand; from 1642011 to 1641361)