Sequence retrieval

Genome: Methanococcoides burtonii DSM 6242
Start position: 503699
End position: 503758
Length: 60

DNA sequence
>NC_007955, from 503699 to 503758 (60 bp); Methanococcoides burtonii DSM 6242 CAACTTGCGCGGTAGCTTGCGCGGTAGCTTGCGCGGTAGCTTGCGCGGTAGCTTGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 503488-504939	Sequence	Mbur_0507 - divergent AAA ATPase (Protein is coded in complementary strand; from 504939 to 503488)