Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 1070886
End position: 1070945
Length: 60

DNA sequence
>NC_007964, from 1070886 to 1070945 (60 bp); Nitrobacter hamburgensis X14 TGAAAGCCACCACCATGGAAGCCGCTACCATGGAAGCCACCGCCGTGGAAGCCGCCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1070613-1071086	Sequence	Nham_0967 - hypothetical protein (Protein is coded in complementary strand; from 1071086 to 1070613)