Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 1238622
End position: 1238645
Length: 24

DNA sequence
>NC_007964, from 1238622 to 1238645 (24 bp); Nitrobacter hamburgensis X14 GCGGCTGCGCCTGCGGATGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1238393-1239844	Sequence	Nham_1096 - XRE family transcriptional regulator (Protein is coded in complementary strand; from 1239844 to 1238393)