Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 1423817
End position: 1423840
Length: 24

DNA sequence
>NC_007964, from 1423817 to 1423840 (24 bp); Nitrobacter hamburgensis X14 GACGCGGTCGCGGCCGCGGAAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1423812-1424834	Sequence	Nham_1266 - transposase, IS4 (Protein is coded in complementary strand; from 1424834 to 1423812)