Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 1832916
End position: 1832945
Length: 30

DNA sequence
>NC_007964, from 1832916 to 1832945 (30 bp); Nitrobacter hamburgensis X14 GCTCCCTCTCTCTCTCTCTCTCTCTCTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1832805-1833674	Sequence	Nham_1630 - hypothetical protein (Protein is coded in complementary strand; from 1833674 to 1832805)