Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 1984629
End position: 1984652
Length: 24

DNA sequence
>NC_007964, from 1984629 to 1984652 (24 bp); Nitrobacter hamburgensis X14 TGGTGGTGGGGGCGGTGGCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1984594-1985988	Sequence	Nham_1783 - hypothetical protein (Protein is coded in complementary strand; from 1985988 to 1984594)