Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 2006267
End position: 2006291
Length: 25

DNA sequence
>NC_007964, from 2006267 to 2006291 (25 bp); Nitrobacter hamburgensis X14 GGCGAGGGGAGCCGAGGTGAGGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2005293-2006726	Sequence	Nham_1804 - tRNA (uracil-5-)-methyltransferase Gid (Protein is coded in complementary strand; from 2006726 to 2005293)