Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 2244557
End position: 2244580
Length: 24

DNA sequence
>NC_007964, from 2244557 to 2244580 (24 bp); Nitrobacter hamburgensis X14 CGCCTTTGCCTTCTCCTTCACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2244483-2244950	Sequence	Nham_2018 - hypothetical protein (Protein is coded in complementary strand; from 2244950 to 2244483)