Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 2284656
End position: 2284679
Length: 24

DNA sequence
>NC_007964, from 2284656 to 2284679 (24 bp); Nitrobacter hamburgensis X14 GTCTCGGTATCGGTTTCGGTCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2283207-2285033	Sequence	Nham_2057 - glucosamine--fructose-6-phosphate aminotransferase (Protein is coded in complementary strand; from 2285033 to 2283207)