Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 2540582
End position: 2540626
Length: 45

DNA sequence
>NC_007964, from 2540582 to 2540626 (45 bp); Nitrobacter hamburgensis X14 CTTGCTCCTTGTCAGCTTGCTGCTTGCCAGCTTGCTCGTGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2540026-2541396	Sequence	Nham_2286 - hypothetical protein (Protein is coded in complementary strand; from 2541396 to 2540026)