Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 2630952
End position: 2630975
Length: 24

DNA sequence
>NC_007964, from 2630952 to 2630975 (24 bp); Nitrobacter hamburgensis X14 TTCGGCTTTGGCCTCGGCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2630839-2631279	Sequence	Nham_2365 - hypothetical protein (Protein is coded in complementary strand; from 2631279 to 2630839)