Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 2714341
End position: 2714385
Length: 45

DNA sequence
>NC_007964, from 2714341 to 2714385 (45 bp); Nitrobacter hamburgensis X14 TGGTCTGTCTTGACGGGATCTGTCTTGACGGGATCTGTCTTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2713534-2714475	Sequence	Nham_2453 - lytic transglycosylase, catalytic (Protein is coded in complementary strand; from 2714475 to 2713534)