Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 2834837
End position: 2834863
Length: 27

DNA sequence
>NC_007964, from 2834837 to 2834863 (27 bp); Nitrobacter hamburgensis X14 CCGTAATAACCGTAATAACCGTAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2834723-2835178	Sequence	Nham_2574 - hypothetical protein (Protein is coded in complementary strand; from 2835178 to 2834723)