Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 295999
End position: 296034
Length: 36

DNA sequence
>NC_007964, from 295999 to 296034 (36 bp); Nitrobacter hamburgensis X14 GGCGGCGGCGGCGGCGACCGCGGCGTCGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 295916-296401	Sequence	Nham_0266 - H+-transporting two-sector ATPase subunit B/B' (Protein is coded in complementary strand; from 296401 to 295916)