Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 3411135
End position: 3411158
Length: 24

DNA sequence
>NC_007964, from 3411135 to 3411158 (24 bp); Nitrobacter hamburgensis X14 CCGCCGCCGCCACCACCGCCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3404778-3412001	Sequence	Nham_3087 - Outer membrane autotransporter barrel (Protein is coded in complementary strand; from 3412001 to 3404778)