Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 3529861
End position: 3529896
Length: 36

DNA sequence
>NC_007964, from 3529861 to 3529896 (36 bp); Nitrobacter hamburgensis X14 AGCCTTGAGCCAAGCCTTGAGCCAAGCCTTGAGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3529296-3530654	Sequence	Nham_3203 - FAD linked oxidase-like protein (Protein is coded in complementary strand; from 3530654 to 3529296)