Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 3763761
End position: 3763784
Length: 24

DNA sequence
>NC_007964, from 3763761 to 3763784 (24 bp); Nitrobacter hamburgensis X14 GTTGTCGTTGGCGTTGCCGTTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3762475-3764565	Sequence	Nham_3417 - peptidyl-dipeptidase Dcp (Protein is coded in complementary strand; from 3764565 to 3762475)