Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 3772712
End position: 3772735
Length: 24

DNA sequence
>NC_007964, from 3772712 to 3772735 (24 bp); Nitrobacter hamburgensis X14 ATGATCGTGATCGTGATCGTGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3772356-3773441	Sequence	Nham_3425 - cobalamin synthesis protein, P47K (Protein is coded in complementary strand; from 3773441 to 3772356)