Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 3822872
End position: 3822907
Length: 36

DNA sequence
>NC_007964, from 3822872 to 3822907 (36 bp); Nitrobacter hamburgensis X14 CGCGTCCGCGTCCGCGTCCGCGTCCGCGTCCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3822733-3823017	Sequence	Nham_3472 - hypothetical protein (Protein is coded in complementary strand; from 3823017 to 3822733)