Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 3861316
End position: 3861342
Length: 27

DNA sequence
>NC_007964, from 3861316 to 3861342 (27 bp); Nitrobacter hamburgensis X14 GCTGCAACTGCTGCAACTGCTGCAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3860565-3861575	Sequence	Nham_3508 - TPR repeat-containing protein (Protein is coded in complementary strand; from 3861575 to 3860565)