Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 3943254
End position: 3943298
Length: 45

DNA sequence
>NC_007964, from 3943254 to 3943298 (45 bp); Nitrobacter hamburgensis X14 GTGGCGATGATGCCCCTGGTGACGATGCCCACGGTGATGATGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3943237-3943539	Sequence	Nham_3588 - hypothetical protein (Protein is coded in complementary strand; from 3943539 to 3943237)