Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 837286
End position: 837310
Length: 25

DNA sequence
>NC_007964, from 837286 to 837310 (25 bp); Nitrobacter hamburgensis X14 CGCGCAGCGCCGCGAAGCGCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 837054-837971	Sequence	Nham_0756 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 837971 to 837054)