Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 857753
End position: 857776
Length: 24

DNA sequence
>NC_007964, from 857753 to 857776 (24 bp); Nitrobacter hamburgensis X14 CGGCGCCGCCGCCAGCGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 857538-858293	Sequence	Nham_0777 - hemolysin A (Protein is coded in complementary strand; from 858293 to 857538)