Sequence retrieval

Genome: Nitrobacter hamburgensis X14
Start position: 862806
End position: 862829
Length: 24

DNA sequence
>NC_007964, from 862806 to 862829 (24 bp); Nitrobacter hamburgensis X14 TGCCGATGCCGATGGCGATGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 862379-863173	Sequence	Nham_0781 - enoyl-CoA hydratase/isomerase (Protein is coded in complementary strand; from 863173 to 862379)