Sequence retrieval

Genome: Baumannia cicadellinicola str. Hc (Homalodisca coagulata)
Start position: 620349
End position: 620375
Length: 27

DNA sequence
>NC_007984, from 620349 to 620375 (27 bp); Baumannia cicadellinicola str. Hc (Homalodisca coagulata) CATACCACCCATACCACCCATACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 620344-621984	Sequence	BCI_0591 groEL chaperonin GroEL (Protein is coded in complementary strand; from 621984 to 620344)