Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1096217
End position: 1096240
Length: 24

DNA sequence
>NC_008048, from 1096217 to 1096240 (24 bp); Sphingopyxis alaskensis RB2256 CCGACGACGACGCCGTCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1096103-1096897	Sequence	Sala_1063 trpA tryptophan synthase subunit alpha (Protein is coded in complementary strand; from 1096897 to 1096103)