Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 162837
End position: 162860
Length: 24

DNA sequence
>NC_008048, from 162837 to 162860 (24 bp); Sphingopyxis alaskensis RB2256 GCGGCGTCGGCGGCGTCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 161199-163562	Sequence	Sala_0162 - PAS/PAC sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 163562 to 161199)