Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1660352
End position: 1660375
Length: 24

DNA sequence
>NC_008048, from 1660352 to 1660375 (24 bp); Sphingopyxis alaskensis RB2256 ACCAGGATCAGGACCAGGACCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1659023-1660414	Sequence	Sala_1584 - O-antigen polymerase (Protein is coded in complementary strand; from 1660414 to 1659023)