Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1692365
End position: 1692388
Length: 24

DNA sequence
>NC_008048, from 1692365 to 1692388 (24 bp); Sphingopyxis alaskensis RB2256 CCGCCAACGCCACAGCCACCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1691545-1693716	Sequence	Sala_1611 - glycine--tRNA ligase (Protein is coded in complementary strand; from 1693716 to 1691545)