Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1855985
End position: 1856008
Length: 24

DNA sequence
>NC_008048, from 1855985 to 1856008 (24 bp); Sphingopyxis alaskensis RB2256 CGCGCCCGCGACGGCGCCCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1855377-1856822	Sequence	Sala_1761 - leucyl aminopeptidase (Protein is coded in complementary strand; from 1856822 to 1855377)