Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1895517
End position: 1895540
Length: 24

DNA sequence
>NC_008048, from 1895517 to 1895540 (24 bp); Sphingopyxis alaskensis RB2256 CCGGCGTCGGCGACGGCGCGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1893890-1895677	Sequence	Sala_1798 - hypothetical protein (Protein is coded in complementary strand; from 1895677 to 1893890)