Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1972655
End position: 1972678
Length: 24

DNA sequence
>NC_008048, from 1972655 to 1972678 (24 bp); Sphingopyxis alaskensis RB2256 CGGCGCCGGTGCCGGTGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1971556-1973004	Sequence	Sala_1875 - cell division protein FtsZ (Protein is coded in complementary strand; from 1973004 to 1971556)