Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1991709
End position: 1991732
Length: 24

DNA sequence
>NC_008048, from 1991709 to 1991732 (24 bp); Sphingopyxis alaskensis RB2256 GTTCGGGATCGGGTTCGAGATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1991681-1992082	Sequence	Sala_1892 - hypothetical protein (Protein is coded in complementary strand; from 1992082 to 1991681)