Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 2028362
End position: 2028385
Length: 24

DNA sequence
>NC_008048, from 2028362 to 2028385 (24 bp); Sphingopyxis alaskensis RB2256 GCGGCGGCGGTGGCGGCGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2028002-2029246	Sequence	Sala_1924 - hypothetical protein (Protein is coded in complementary strand; from 2029246 to 2028002)