Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 2269963
End position: 2269986
Length: 24

DNA sequence
>NC_008048, from 2269963 to 2269986 (24 bp); Sphingopyxis alaskensis RB2256 GTCCTCGCCCTCTTCCTCGGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2269181-2270125	Sequence	Sala_2158 - hypothetical protein (Protein is coded in complementary strand; from 2270125 to 2269181)