Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 2514896
End position: 2514919
Length: 24

DNA sequence
>NC_008048, from 2514896 to 2514919 (24 bp); Sphingopyxis alaskensis RB2256 TGGCGATCGCGATGCCGATGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2514466-2515710	Sequence	Sala_2385 - Bcr/CflA subfamily drug resistance transporter (Protein is coded in complementary strand; from 2515710 to 2514466)