Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 2859768
End position: 2859791
Length: 24

DNA sequence
>NC_008048, from 2859768 to 2859791 (24 bp); Sphingopyxis alaskensis RB2256 TGTCGGTGTCGACGTCGGTGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2859332-2860153	Sequence	Sala_2712 - hypothetical protein (Protein is coded in complementary strand; from 2860153 to 2859332)