Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 2872871
End position: 2872894
Length: 24

DNA sequence
>NC_008048, from 2872871 to 2872894 (24 bp); Sphingopyxis alaskensis RB2256 GGCGGCGGCTGCTGCGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2872638-2873243	Sequence	Sala_2727 - 30S ribosomal protein S16 (Protein is coded in complementary strand; from 2873243 to 2872638)