Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 376865
End position: 376888
Length: 24

DNA sequence
>NC_008048, from 376865 to 376888 (24 bp); Sphingopyxis alaskensis RB2256 GGTCGCCGTCGCGGGCGCGGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 376582-377292	Sequence	Sala_0365 - ACP phosphodiesterase (Protein is coded in complementary strand; from 377292 to 376582)