Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 44144
End position: 44167
Length: 24

DNA sequence
>NC_008048, from 44144 to 44167 (24 bp); Sphingopyxis alaskensis RB2256 GCGTCATCGTCAGCGCCAGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 42262-44322	Sequence	Sala_0043 - thiol:disulfide interchange protein (Protein is coded in complementary strand; from 44322 to 42262)