Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 531145
End position: 531168
Length: 24

DNA sequence
>NC_008048, from 531145 to 531168 (24 bp); Sphingopyxis alaskensis RB2256 TCGGGGTCGAGGTCGGCGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 531064-531351	Sequence	Sala_0513 - chorismate mutase (Protein is coded in complementary strand; from 531351 to 531064)