Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1081446
End position: 1081470
Length: 25

DNA sequence
>NC_008048, from 1081446 to 1081470 (25 bp); Sphingopyxis alaskensis RB2256 GGCGCAGCGCGGCGCGGCGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1080233-1081546	Sequence	Sala_1047 - hypothetical protein (Protein is coded in complementary strand; from 1081546 to 1080233)