Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 300980
End position: 301004
Length: 25

DNA sequence
>NC_008048, from 300980 to 301004 (25 bp); Sphingopyxis alaskensis RB2256 TCCGCTCGGCGCCGCTTCGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 300409-301032	Sequence	Sala_0301 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 301032 to 300409)