Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 3100135
End position: 3100159
Length: 25

DNA sequence
>NC_008048, from 3100135 to 3100159 (25 bp); Sphingopyxis alaskensis RB2256 GCCGCGCCGACCCGCGCCACGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3099872-3100360	Sequence	Sala_2957 - ECF subfamily RNA polymerase sigma-24 factor (Protein is coded in complementary strand; from 3100360 to 3099872)