Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1172374
End position: 1172400
Length: 27

DNA sequence
>NC_008048, from 1172374 to 1172400 (27 bp); Sphingopyxis alaskensis RB2256 GAGCGCCGCGAGCGCCTCGATCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1172105-1172557	Sequence	Sala_1134 - ribonuclease H (Protein is coded in complementary strand; from 1172557 to 1172105)