Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1357323
End position: 1357349
Length: 27

DNA sequence
>NC_008048, from 1357323 to 1357349 (27 bp); Sphingopyxis alaskensis RB2256 GCGATCATCGCGATCATCGCGATCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1356315-1357868	Sequence	Sala_1297 - proton-translocating NADH-quinone oxidoreductase subunit M (Protein is coded in complementary strand; from 1357868 to 1356315)