Sequence retrieval

Genome: Sphingopyxis alaskensis RB2256
Start position: 1465251
End position: 1465277
Length: 27

DNA sequence
>NC_008048, from 1465251 to 1465277 (27 bp); Sphingopyxis alaskensis RB2256 CTGCTGCATCTGTTGCATCTGCTGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1465186-1465833	Sequence	Sala_1412 - peptidylprolyl isomerase, FKBP-type (Protein is coded in complementary strand; from 1465833 to 1465186)